ID: 1134057805_1134057814

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1134057805 1134057814
Species Human (GRCh38) Human (GRCh38)
Location 16:11181307-11181329 16:11181350-11181372
Sequence CCAGGAGTGTGGGAAGGCCCACA CACTCAGGTCATAGCCTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 197} {0: 1, 1: 0, 2: 0, 3: 20, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!