ID: 1134058245_1134058255

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1134058245 1134058255
Species Human (GRCh38) Human (GRCh38)
Location 16:11183332-11183354 16:11183350-11183372
Sequence CCCCCTTCCCCCACGTCCTACTG TACTGCTCTGTGGCACTTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 467} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!