ID: 1134075349_1134075354

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1134075349 1134075354
Species Human (GRCh38) Human (GRCh38)
Location 16:11287120-11287142 16:11287135-11287157
Sequence CCTGTTCCAGGATCCCGTCTCCC CGTCTCCCTTTAGGCTCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 170} {0: 1, 1: 0, 2: 0, 3: 7, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!