|
Left Crispr |
Right Crispr |
| Crispr ID |
1134078510 |
1134078513 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:11308868-11308890
|
16:11308886-11308908
|
| Sequence |
CCAAGAGTGCAGGGATGCCTGGG |
CTGGGTCCACAGCTGCAATTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 24, 1: 92, 2: 139, 3: 195, 4: 1227} |
{0: 1, 1: 3, 2: 25, 3: 81, 4: 286} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|