ID: 1134086667_1134086675

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1134086667 1134086675
Species Human (GRCh38) Human (GRCh38)
Location 16:11362111-11362133 16:11362133-11362155
Sequence CCCACCCCCATGGACCGAGAGGT TGATACTATTAGAGTTATATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 68} {0: 1, 1: 0, 2: 1, 3: 19, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!