ID: 1134103438_1134103442

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1134103438 1134103442
Species Human (GRCh38) Human (GRCh38)
Location 16:11469123-11469145 16:11469139-11469161
Sequence CCTGGGGAGGTGTCAGGTGCAGA GTGCAGACACAGGTGGGCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 326} {0: 1, 1: 0, 2: 4, 3: 44, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!