ID: 1134121232_1134121241

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1134121232 1134121241
Species Human (GRCh38) Human (GRCh38)
Location 16:11586536-11586558 16:11586551-11586573
Sequence CCAGGGGCCGTCCTCTCCGGGGA TCCGGGGAGGGGGACGCGGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 59, 4: 420}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!