ID: 1134143622_1134143633

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1134143622 1134143633
Species Human (GRCh38) Human (GRCh38)
Location 16:11742806-11742828 16:11742849-11742871
Sequence CCAATCCCGCAGCTCGCCGCACC GTCAGCCGCGCCGCCGCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 97} {0: 1, 1: 0, 2: 2, 3: 31, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!