ID: 1134143624_1134143632

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1134143624 1134143632
Species Human (GRCh38) Human (GRCh38)
Location 16:11742812-11742834 16:11742848-11742870
Sequence CCGCAGCTCGCCGCACCCGCTAA CGTCAGCCGCGCCGCCGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 65} {0: 1, 1: 0, 2: 3, 3: 20, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!