ID: 1134163890_1134163905

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1134163890 1134163905
Species Human (GRCh38) Human (GRCh38)
Location 16:11915327-11915349 16:11915373-11915395
Sequence CCGGCGCCCGGCCGGACTTCCTC ACGGCCTCCCGCGCCGCTGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 119} {0: 1, 1: 0, 2: 0, 3: 4, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!