ID: 1134168439_1134168447

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1134168439 1134168447
Species Human (GRCh38) Human (GRCh38)
Location 16:11949009-11949031 16:11949034-11949056
Sequence CCGCATGCCTGTAATCCCAGCTT TGTAAGGGAGGCGGCTGAGATGG
Strand - +
Off-target summary {0: 4, 1: 320, 2: 1588, 3: 3280, 4: 4331} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!