ID: 1134220342_1134220347

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1134220342 1134220347
Species Human (GRCh38) Human (GRCh38)
Location 16:12348618-12348640 16:12348657-12348679
Sequence CCTTCCAGGTCCTCTGCTCTTCA CTAGCTCAGCATCACAGTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 331} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!