ID: 1134238466_1134238476 |
View in Genome Browser |
Spacer: 14 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1134238466 | 1134238476 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 16:12486307-12486329 | 16:12486344-12486366 |
Sequence | CCTTAATTTCACCTCCTCTGCAG | TAGCATATTCACAGGTTCTGGGG |
Strand | - | + |
Off-target summary | No data | {0: 8, 1: 97, 2: 290, 3: 604, 4: 1209} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |