ID: 1134238468_1134238474

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1134238468 1134238474
Species Human (GRCh38) Human (GRCh38)
Location 16:12486318-12486340 16:12486342-12486364
Sequence CCTCCTCTGCAGTGGCCCCTGTA AGTAGCATATTCACAGGTTCTGG
Strand - +
Off-target summary No data {0: 4, 1: 31, 2: 112, 3: 358, 4: 728}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!