ID: 1134238469_1134238476

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1134238469 1134238476
Species Human (GRCh38) Human (GRCh38)
Location 16:12486321-12486343 16:12486344-12486366
Sequence CCTCTGCAGTGGCCCCTGTACAG TAGCATATTCACAGGTTCTGGGG
Strand - +
Off-target summary No data {0: 8, 1: 97, 2: 290, 3: 604, 4: 1209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!