ID: 1134239479_1134239481

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1134239479 1134239481
Species Human (GRCh38) Human (GRCh38)
Location 16:12494870-12494892 16:12494886-12494908
Sequence CCCTGCTTCACATCAGTGGCACC TGGCACCATCTTAATAAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 181} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!