ID: 1134247654_1134247660

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1134247654 1134247660
Species Human (GRCh38) Human (GRCh38)
Location 16:12551994-12552016 16:12552021-12552043
Sequence CCTGCTGGTCCCTGTCTCTAAAA TGGCAAGTCCAGGCTCAGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 260} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!