ID: 1134264689_1134264695

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1134264689 1134264695
Species Human (GRCh38) Human (GRCh38)
Location 16:12683130-12683152 16:12683178-12683200
Sequence CCAAGAAGGGGGTACTGCATCCA TGAGATTCCGTTTGAATAACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!