ID: 1134265604_1134265609

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1134265604 1134265609
Species Human (GRCh38) Human (GRCh38)
Location 16:12690201-12690223 16:12690222-12690244
Sequence CCCTGTTTCATGAAAGACACCAT ATCAAGAAGGCCAAGTGTGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 13, 3: 210, 4: 1597}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!