ID: 1134290881_1134290889

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1134290881 1134290889
Species Human (GRCh38) Human (GRCh38)
Location 16:12902199-12902221 16:12902220-12902242
Sequence CCGCTCCGGGGCCGCCTCCGGAG AGAGGCCAGCGAGGGCGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 174} {0: 1, 1: 0, 2: 2, 3: 42, 4: 380}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!