ID: 1134401104_1134401109

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1134401104 1134401109
Species Human (GRCh38) Human (GRCh38)
Location 16:13910506-13910528 16:13910538-13910560
Sequence CCTAAAAACACCATCTGGGCTTG GCCTGTGATCCCAGCACTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 162} {0: 2206, 1: 222624, 2: 272239, 3: 185198, 4: 147020}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!