ID: 1134401107_1134401116

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1134401107 1134401116
Species Human (GRCh38) Human (GRCh38)
Location 16:13910516-13910538 16:13910551-13910573
Sequence CCATCTGGGCTTGGTGGCTCATG GCACTTTGGGAGGCTGAGGCGGG
Strand - +
Off-target summary No data {0: 59629, 1: 175979, 2: 229415, 3: 270535, 4: 297068}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!