ID: 1134401110_1134401117

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1134401110 1134401117
Species Human (GRCh38) Human (GRCh38)
Location 16:13910539-13910561 16:13910554-13910576
Sequence CCTGTGATCCCAGCACTTTGGGA CTTTGGGAGGCTGAGGCGGGTGG
Strand - +
Off-target summary {0: 2928, 1: 292542, 2: 261985, 3: 151313, 4: 136324} {0: 20304, 1: 108143, 2: 164903, 3: 177131, 4: 137557}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!