ID: 1134407173_1134407180

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1134407173 1134407180
Species Human (GRCh38) Human (GRCh38)
Location 16:13970632-13970654 16:13970651-13970673
Sequence CCACACAGCCACTGCTGGGGGAA GGAAGGAGGAAGGGTGGCATTGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 13, 3: 69, 4: 368} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!