ID: 1134411298_1134411302

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1134411298 1134411302
Species Human (GRCh38) Human (GRCh38)
Location 16:14004706-14004728 16:14004736-14004758
Sequence CCGAGTGCTGAGCTCTGTGCTGC ATTTGGAAGAGGAAGCTTCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 23, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!