ID: 1134511040_1134511046

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1134511040 1134511046
Species Human (GRCh38) Human (GRCh38)
Location 16:14846995-14847017 16:14847048-14847070
Sequence CCAGCCTGGACAACTTAGGGAGA TATCAAGTAGAGTCCCACGGGGG
Strand - +
Off-target summary {0: 3, 1: 238, 2: 3932, 3: 25285, 4: 113290} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!