ID: 1134524538_1134524552

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1134524538 1134524552
Species Human (GRCh38) Human (GRCh38)
Location 16:14933553-14933575 16:14933599-14933621
Sequence CCCAGGGCCGCCACTTTCCAGTG CACCAAAGGCTGCTCGGGAAGGG
Strand - +
Off-target summary {0: 6, 1: 1, 2: 1, 3: 16, 4: 154} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!