ID: 1134537254_1134537257

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1134537254 1134537257
Species Human (GRCh38) Human (GRCh38)
Location 16:15035824-15035846 16:15035844-15035866
Sequence CCCGGCCTGGGGAGCATGTTGGT GGTGTCAAGCTAGCAGCTCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 226} {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!