ID: 1134537801_1134537818

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1134537801 1134537818
Species Human (GRCh38) Human (GRCh38)
Location 16:15040714-15040736 16:15040761-15040783
Sequence CCCCAGAGCACTGGCAGGAGAAA GGGGAGAGGGAAACAAAACCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 43, 4: 483}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!