ID: 1134537819_1134537828

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1134537819 1134537828
Species Human (GRCh38) Human (GRCh38)
Location 16:15040779-15040801 16:15040794-15040816
Sequence CCAGGCACTTTCCCAGCTCCTGG GCTCCTGGGAAGGGTGGGCATGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 62, 4: 694} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!