ID: 1134537908_1134537919

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1134537908 1134537919
Species Human (GRCh38) Human (GRCh38)
Location 16:15041399-15041421 16:15041433-15041455
Sequence CCCTCCTTCCTGGTAGACGAGGG AACTGAGGCTCGGCAGATGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 18, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!