|
Left Crispr |
Right Crispr |
| Crispr ID |
1134539935 |
1134539949 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:15056037-15056059
|
16:15056074-15056096
|
| Sequence |
CCCGCCGCCCCCGCCCCTCGGGC |
CGTCCTGCCCCGCCCCACCGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 14, 3: 139, 4: 988} |
{0: 1, 1: 0, 2: 3, 3: 37, 4: 328} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|