ID: 1134588637_1134588653

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1134588637 1134588653
Species Human (GRCh38) Human (GRCh38)
Location 16:15434474-15434496 16:15434505-15434527
Sequence CCCTGCCCCTTCTGGGTACCCGT CCGGGCGCTGGCGGCGGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 166} {0: 1, 1: 6, 2: 79, 3: 389, 4: 1826}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!