ID: 1134588637_1134588654

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1134588637 1134588654
Species Human (GRCh38) Human (GRCh38)
Location 16:15434474-15434496 16:15434510-15434532
Sequence CCCTGCCCCTTCTGGGTACCCGT CGCTGGCGGCGGCGGAGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 166} {0: 1, 1: 0, 2: 4, 3: 92, 4: 775}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!