ID: 1134602926_1134602931

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1134602926 1134602931
Species Human (GRCh38) Human (GRCh38)
Location 16:15547640-15547662 16:15547683-15547705
Sequence CCCAGCCACTTTCAGCTTTTAAT CCCTGCTGAAATAGCTGTCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!