ID: 1134618257_1134618271

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1134618257 1134618271
Species Human (GRCh38) Human (GRCh38)
Location 16:15668509-15668531 16:15668557-15668579
Sequence CCTGCCTTGGCCTCCCAAATTGC CTGGCCAGGGAGACATTTTTAGG
Strand - +
Off-target summary {0: 725, 1: 62450, 2: 181508, 3: 241157, 4: 278888} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!