ID: 1134618261_1134618275

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1134618261 1134618275
Species Human (GRCh38) Human (GRCh38)
Location 16:15668519-15668541 16:15668566-15668588
Sequence CCTCCCAAATTGCTGGGATTATA GAGACATTTTTAGGGTATGGAGG
Strand - +
Off-target summary {0: 345, 1: 32646, 2: 349191, 3: 326783, 4: 293515} {0: 1, 1: 0, 2: 0, 3: 18, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!