ID: 1134618263_1134618272

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1134618263 1134618272
Species Human (GRCh38) Human (GRCh38)
Location 16:15668522-15668544 16:15668558-15668580
Sequence CCCAAATTGCTGGGATTATAGGC TGGCCAGGGAGACATTTTTAGGG
Strand - +
Off-target summary {0: 291, 1: 24949, 2: 268587, 3: 336037, 4: 351540} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!