ID: 1134631274_1134631280

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1134631274 1134631280
Species Human (GRCh38) Human (GRCh38)
Location 16:15757819-15757841 16:15757838-15757860
Sequence CCCCTCACCGGTCGCTCGATGAG TGAGCTCGATGCAGGGCTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 23} {0: 1, 1: 0, 2: 3, 3: 15, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!