ID: 1134634009_1134634014

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1134634009 1134634014
Species Human (GRCh38) Human (GRCh38)
Location 16:15778594-15778616 16:15778628-15778650
Sequence CCAGGGGTCCGGTCCACACATGT ACCACAATGCCTGCTGTTAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 79} {0: 1, 1: 0, 2: 1, 3: 14, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!