ID: 1134649596_1134649610

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1134649596 1134649610
Species Human (GRCh38) Human (GRCh38)
Location 16:15898195-15898217 16:15898246-15898268
Sequence CCTCCCCCTCCTCCTCTTTCTTC CCCCCAACCCCCTCTCTACTGGG
Strand - +
Off-target summary {0: 3, 1: 42, 2: 638, 3: 3072, 4: 11991} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!