ID: 1134683286_1134683295

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1134683286 1134683295
Species Human (GRCh38) Human (GRCh38)
Location 16:16141514-16141536 16:16141550-16141572
Sequence CCCTGCCCCTGGTGCCCTGAGAC CACGCCCCCAGGAATGCAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 367} {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!