ID: 1134684461_1134684468

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1134684461 1134684468
Species Human (GRCh38) Human (GRCh38)
Location 16:16148936-16148958 16:16148955-16148977
Sequence CCTGGTTTTTGTGTCCTTGGAGC GAGCTCATCTCTGGTGGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 174} {0: 1, 1: 0, 2: 3, 3: 14, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!