ID: 1134687680_1134687685

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1134687680 1134687685
Species Human (GRCh38) Human (GRCh38)
Location 16:16169988-16170010 16:16170005-16170027
Sequence CCGCTGTGCCTCCCACCAGAAGC AGAAGCACCATTTCCCCGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 394} {0: 1, 1: 0, 2: 3, 3: 4, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!