ID: 1134759157_1134759164

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1134759157 1134759164
Species Human (GRCh38) Human (GRCh38)
Location 16:16698241-16698263 16:16698287-16698309
Sequence CCTGTGCCCCTGGGTTGGAAGAT ATGCTTATGAGTGAGGTTATGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!