ID: 1134790202_1134790206

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1134790202 1134790206
Species Human (GRCh38) Human (GRCh38)
Location 16:16982826-16982848 16:16982849-16982871
Sequence CCTTCAAAGGGTGTAACCAACTG GAGACCTCTAAAAGGCACCTAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 21, 3: 36, 4: 86} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!