ID: 1134847872_1134847879

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1134847872 1134847879
Species Human (GRCh38) Human (GRCh38)
Location 16:17456097-17456119 16:17456119-17456141
Sequence CCAGCTTCACTCTGTGCACACAG GAGGATGGGAATCAGGGTGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 48, 4: 521}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!