ID: 1134972747_1134972752

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1134972747 1134972752
Species Human (GRCh38) Human (GRCh38)
Location 16:18544887-18544909 16:18544916-18544938
Sequence CCAGCAAGCCAGAAGTGCCCTCA CTTCCGGTCACTAACACCCCAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 19, 4: 199} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!