ID: 1134974861_1134974865

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1134974861 1134974865
Species Human (GRCh38) Human (GRCh38)
Location 16:18562164-18562186 16:18562204-18562226
Sequence CCAGAGCCGCCGCGCACGCGCGC AGCCCCAGAAGAGAGAACTAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 25, 4: 225} {0: 3, 1: 0, 2: 1, 3: 17, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!