ID: 1135004700_1135004708

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1135004700 1135004708
Species Human (GRCh38) Human (GRCh38)
Location 16:18809355-18809377 16:18809389-18809411
Sequence CCCTGGGGTTGCAGGCCATGGTG CCTGAGTGCAGCTGTCCTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 275} {0: 1, 1: 0, 2: 1, 3: 25, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!